nf-core/smrnaseq
A small-RNA sequencing analysis pipeline
2.3.0). The latest
stable release is
2.4.0
.
Define where the pipeline should find input data and save output data.
Path to comma-separated file containing information about the samples in the experiment.
string^\S+\.csv$You will need to create a design file with information about the samples in your experiment before running the pipeline. Use this parameter to specify its location. It has to be a comma-separated file with 3 columns, and a header row. See usage docs.
Protocol for constructing smRNA-seq libraries.
stringPresets for trimming parameters and 3' adapter sequence with a specified protocol.
| Protocol | Library Prep Kit | Trimming Parameter | 3' Adapter Sequence |
| :------------ | :-------------------------------------- | :-------------------------------------- | :--------------------- |
| illumina | Illumina TruSeq Small RNA | clip_r1 = 0 three_prime_clip_r1 = 0 | TGGAATTCTCGGGTGCCAAGG |
| nextflex | BIOO SCIENTIFIC NEXTFLEX Small RNA-Seq | clip_r1 = 4 three_prime_clip_r1 = 4 | TGGAATTCTCGGGTGCCAAGG |
| qiaseq | QIAGEN QIAseq miRNA | clip_r1 = 0 three_prime_clip_r1 = 0 | AACTGTAGGCACCATCAAT |
| cats | Diagenode CATS Small RNA-seq | clip_r1 = 3 three_prime_clip_r1 = 0 | AAAAAAAAAAA + GATCGGAAGAGCACACGTCTG (only polyA is used for trimming) |
| custom | user defined | user defined | user defined |
NB: When running
--protocol customthe user must define the 3' Adapter Sequence.
If trimming parameters aren't provided the pipeline will deafult toclip_R1 = 0andthree_prime_clip_R1 = 0(i.e. no extra clipping).
The output directory where the results will be saved. You have to use absolute paths to storage on Cloud infrastructure.
stringEmail address for completion summary.
string^([a-zA-Z0-9_\-\.]+)@([a-zA-Z0-9_\-\.]+)\.([a-zA-Z]{2,5})$Set this parameter to your e-mail address to get a summary e-mail with details of the run sent to you when the workflow exits. If set in your user config file (~/.nextflow/config) then you don't need to specify this on the command line for every run.
MultiQC report title. Printed as page header, used for filename if not otherwise specified.
stringOptions for processing reads with unique molecular identifiers
Enable UMI-based read deduplication.
booleanUMI pattern to use. Can be either 'string' (default) or 'regex'.
stringstringMore details can be found in the UMI-tools documentation.
UMI grouping method
stringdirAvailable options are dir, cc, adj
Skip the UMI extraction from the reads before deduplication. Please note, if this parameter is set to false, the reads will be deduplicated solely on insert sequence. UMIs might be extracted after deduplication depending on the set umitools_bc_pattern nevertheless if with_umi is set to True.
booleantrueThe UMI barcode pattern to use e.g. 'NNNNNN' indicates that the first 6 nucleotides of the read are from the UMI.
stringMore details can be found in the UMI-tools documentation.
After UMI barcode extraction discard either R1 or R2 by setting this parameter to 1 or 2, respectively.
integerIf this option is specified, intermediate FastQ and BAM files produced by UMI-tools are also saved in the results directory.
booleanReference genome related files and options required for the workflow.
Name of iGenomes reference.
stringIf using a reference genome configured in the pipeline using iGenomes, use this parameter to give the ID for the reference. This is then used to build the full paths for all required reference genome files e.g. --genome GRCh38.
See the nf-core website docs for more details.
Boolean whether MirGeneDB should be used instead of miRBase
booleanThis allows you to use MirGeneDB instead of miRBase as the database.
Note that you will need to set the additional flags --mirgenedb_species, --mirgenedb_gff, --mirgenedb_mature and --mirgenedb_hairpin
Species for miRTrace.
stringThis is automatically set when using --genome. Example values: hsa, mmu...
Note that mirTrace relies on miRBase for its species reference. See available references here.
Species of MirGeneDB.
stringThis replaces the value of --mirtrace_species if --mirgenedb is used.
Note the difference in case for species names used in MirGeneDB and miRBase. See https://www.mirgenedb.org/browse for more information.
Path to FASTA genome file.
string^\S+\.fn?a(sta)?(\.gz)?$This parameter is mandatory if --genome is not specified. If you don't have a BWA index available this will be generated for you automatically. Combine with --save_reference to save BWA index for future runs.
GFF/GTF file with coordinates positions of precursor and miRNAs.
stringmiRBase .gff3 file, typically downloaded from https://mirbase.org/download/CURRENT/genomes/
If using iGenomes with --genome this file will be downloaded from miRBase automatically during the pipeline run.
GFF/GTF file with coordinates positions of precursor and miRNAs.
stringMirGeneDB .gff3 file, typically downloaded from [https://mirgenedb.org/download]. This replaces the value of --mirna_gff if --mirgenedb is used.
Path to FASTA file with mature miRNAs.
stringhttps://mirbase.org/download/mature.faTypically this will be the mature.fa file from miRBase. Can be given either as a plain text .fa file or a compressed .gz file.
Defaults to the current miRBase release URL, from which the file will be downloaded.
Path to FASTA file with MirGeneDB mature miRNAs.
stringThis file needs to be downloaded from [https://mirgenedb.org/download]. Can be given either as a plain text .fa file or a compressed .gz file.
Path to FASTA file with miRNAs precursors.
stringhttps://mirbase.org/download/hairpin.faTypically this will be the mature.fa file from miRBase. Can be given either as a plain text .fa file or a compressed .gz file.
Defaults to the current miRBase release URL, from which the file will be downloaded.
Path to FASTA file with miRNAs precursors.
stringThis file needs to be downloaded from [https://mirgenedb.org/download]. Can be given either as a plain text .fa file or a compressed .gz file.
Note that MirGeneDB does not have a dedicated hairpin file. The equivalent is the Precursor sequences.
Path to a Bowtie 1 index directory
stringPoint to the directory created by Bowtie 1 when indexing. Bowtie 1 indices consist of six files:
genome.1.ebwt, genome.2.ebwt, genome.3.ebwt, genome.4.ebwt, genome.rev.1.ebwt, genome.rev.2.ebwt
Save generated reference genome files to results.
booleanSaving generated references means that you can use them for future pipeline runs, reducing processing times.
Save aligned reads of initial mapping in bam format.
booleanSave aligned reads of initial bowtie mapping.
Save aligned reads of miRNA quant subworkflow in bam format.
booleantrueSave aligned reads of the bowtie runs in BOWTIE_MAP_MATURE, BOWTIE_MAP_HAIRPIN, and BOWTIE_MAP_SEQCLUSTER.
Do not load the iGenomes reference config.
booleanDo not load igenomes.config when running the pipeline. You may choose this option if you observe clashes between custom parameters and those supplied in igenomes.config.
Options for trimming reads and primers.
The number of basepairs to remove from the 5' end of read 1.
integerThe number of basepairs to remove from the 3' end of read 1 AFTER adapter/quality trimming has been performed.
integerSequencing adapter sequence to use for trimming.
stringAGATCGGAAGAGCACACGTCTGAACTCCAGTCATrim FastQ files
booleantrueMinimum filter length for raw reads.
integer17Maximum filter length for raw reads.
integer100Save reads failing trimming
booleanFastA with known miRNA adapter sequences for adapter trimming
string${projectDir}/assets/known_adapters.faMinimum number of reads required in input file to use it
integer10Save merged reads.
booleantrueOptions to remove contamination from the reads.
Enables the contamination filtering.
booleanPath to the rRNA fasta file to be used as contamination database.
stringPath to the tRNA fasta file to be used as contamination database.
stringPath to the cDNA fasta file to be used as contamination database.
stringPath to the ncRNA fasta file to be used as contamination database.
stringPath to the piRNA fasta file to be used as contamination database.
stringPath to an additional fasta file to be used as contamination database.
stringSwitches to skip specific pipeline steps, if desired.
Skip FastQC
booleanSkip miRDeep
booleanSkip MultiQC
booleanSkip FastP
booleanParameters used to describe centralised config profiles. These should not be edited.
Git commit id for Institutional configs.
stringmasterBase directory for Institutional configs.
stringhttps://raw.githubusercontent.com/nf-core/configs/masterIf you're running offline, Nextflow will not be able to fetch the institutional config files from the internet. If you don't need them, then this is not a problem. If you do need them, you should download the files from the repo and tell Nextflow where to find them with this parameter.
Institutional config name.
stringInstitutional config description.
stringInstitutional config contact information.
stringInstitutional config URL link.
stringSet the top limit for requested resources for any single job.
Maximum number of CPUs that can be requested for any single job.
integer16Use to set an upper-limit for the CPU requirement for each process. Should be an integer e.g. --max_cpus 1
Maximum amount of memory that can be requested for any single job.
string128.GB^\d+(\.\d+)?\.?\s*(K|M|G|T)?B$Use to set an upper-limit for the memory requirement for each process. Should be a string in the format integer-unit e.g. --max_memory '8.GB'
Maximum amount of time that can be requested for any single job.
string240.h^(\d+\.?\s*(s|m|h|d|day)\s*)+$Use to set an upper-limit for the time requirement for each process. Should be a string in the format integer-unit e.g. --max_time '2.h'
Less common options for the pipeline, typically set in a config file.
Display help text.
booleanDisplay version and exit.
booleanMethod used to save pipeline results to output directory.
stringThe Nextflow publishDir option specifies which intermediate files should be saved to the output directory. This option tells the pipeline what method should be used to move these files. See Nextflow docs for details.
Email address for completion summary, only when pipeline fails.
string^([a-zA-Z0-9_\-\.]+)@([a-zA-Z0-9_\-\.]+)\.([a-zA-Z]{2,5})$An email address to send a summary email to when the pipeline is completed - ONLY sent if the pipeline does not exit successfully.
Send plain-text email instead of HTML.
booleanFile size limit when attaching MultiQC reports to summary emails.
string25.MB^\d+(\.\d+)?\.?\s*(K|M|G|T)?B$Do not use coloured log outputs.
booleanIncoming hook URL for messaging service
stringIncoming hook URL for messaging service. Currently, MS Teams and Slack are supported.
Custom config file to supply to MultiQC.
stringCustom logo file to supply to MultiQC. File name must also be set in the MultiQC config file
stringCustom MultiQC yaml file containing HTML including a methods description.
stringBoolean whether to validate parameters against the schema at runtime
booleantrueShow all params when using --help
booleanBy default, parameters set as hidden in the schema are not shown on the command line when a user runs with --help. Specifying this option will tell the pipeline to show all parameters.
Validation of parameters fails when an unrecognised parameter is found.
booleanBy default, when an unrecognised parameter is found, it returns a warinig.
Validation of parameters in lenient more.
booleanAllows string values that are parseable as numbers or booleans. For further information see JSONSchema docs.